Python 2.7.9 (default, Apr  2 2015, 15:33:21) 
[GCC 4.9.2] on linux2
Type "copyright", "credits" or "license()" for more information.
>>> 

>>> mystring = 'Hello CSCI 150!'
>>> type(mystring)
<type 'str'>
>>> mystring[5]
' '
>>> mystring[0]
'H'
>>> len(mystring)
15
>>> mystring[14]
'!'
>>> mystring[15]

Traceback (most recent call last):
  File "<pyshell#7>", line 1, in <module>
    mystring[15]
IndexError: string index out of range
>>> mystring[-1]
'!'
>>> mystring[-2]
'0'
>>> mystring[2:5]
'llo'
>>> mystring[2:7]
'llo C'
>>> mystring[0:7] + mystring[7:15]
'Hello CSCI 150!'
>>> mystring[2:-2]
'llo CSCI 15'
>>> mystring[2:]  # starts at 2, all the way to the end
'llo CSCI 150!'
>>> mystring[:7]  # start at beginning, up to but not including 7
'Hello C'
>>> mystring[:]
'Hello CSCI 150!'
>>> mystring * 3
'Hello CSCI 150!Hello CSCI 150!Hello CSCI 150!'
>>> help(str)
Help on class str in module __builtin__:

class str(basestring)
 |  str(object='') -> string
 |  
 |  Return a nice string representation of the object.
 |  If the argument is a string, the return value is the same object.
 |  
 |  Method resolution order:
 |      str
 |      basestring
 |      object
 |  
 |  Methods defined here:
 |  
 |  __add__(...)
 |      x.__add__(y) <==> x+y
 |  
 |  __contains__(...)
 |      x.__contains__(y) <==> y in x
 |  
 |  __eq__(...)
 |      x.__eq__(y) <==> x==y
 |  
 |  __format__(...)
 |      S.__format__(format_spec) -> string
 |      
 |      Return a formatted version of S as described by format_spec.
 |  
 |  __ge__(...)
 |      x.__ge__(y) <==> x>=y
 |  
 |  __getattribute__(...)
 |      x.__getattribute__('name') <==> x.name
 |  
 |  __getitem__(...)
 |      x.__getitem__(y) <==> x[y]
 |  
 |  __getnewargs__(...)
 |  
 |  __getslice__(...)
 |      x.__getslice__(i, j) <==> x[i:j]
 |      
 |      Use of negative indices is not supported.
 |  
 |  __gt__(...)
 |      x.__gt__(y) <==> x>y
 |  
 |  __hash__(...)
 |      x.__hash__() <==> hash(x)
 |  
 |  __le__(...)
 |      x.__le__(y) <==> x<=y
 |  
 |  __len__(...)
 |      x.__len__() <==> len(x)
 |  
 |  __lt__(...)
 |      x.__lt__(y) <==> x<y
 |  
 |  __mod__(...)
 |      x.__mod__(y) <==> x%y
 |  
 |  __mul__(...)
 |      x.__mul__(n) <==> x*n
 |  
 |  __ne__(...)
 |      x.__ne__(y) <==> x!=y
 |  
 |  __repr__(...)
 |      x.__repr__() <==> repr(x)
 |  
 |  __rmod__(...)
 |      x.__rmod__(y) <==> y%x
 |  
 |  __rmul__(...)
 |      x.__rmul__(n) <==> n*x
 |  
 |  __sizeof__(...)
 |      S.__sizeof__() -> size of S in memory, in bytes
 |  
 |  __str__(...)
 |      x.__str__() <==> str(x)
 |  
 |  capitalize(...)
 |      S.capitalize() -> string
 |      
 |      Return a copy of the string S with only its first character
 |      capitalized.
 |  
 |  center(...)
 |      S.center(width[, fillchar]) -> string
 |      
 |      Return S centered in a string of length width. Padding is
 |      done using the specified fill character (default is a space)
 |  
 |  count(...)
 |      S.count(sub[, start[, end]]) -> int
 |      
 |      Return the number of non-overlapping occurrences of substring sub in
 |      string S[start:end].  Optional arguments start and end are interpreted
 |      as in slice notation.
 |  
 |  decode(...)
 |      S.decode([encoding[,errors]]) -> object
 |      
 |      Decodes S using the codec registered for encoding. encoding defaults
 |      to the default encoding. errors may be given to set a different error
 |      handling scheme. Default is 'strict' meaning that encoding errors raise
 |      a UnicodeDecodeError. Other possible values are 'ignore' and 'replace'
 |      as well as any other name registered with codecs.register_error that is
 |      able to handle UnicodeDecodeErrors.
 |  
 |  encode(...)
 |      S.encode([encoding[,errors]]) -> object
 |      
 |      Encodes S using the codec registered for encoding. encoding defaults
 |      to the default encoding. errors may be given to set a different error
 |      handling scheme. Default is 'strict' meaning that encoding errors raise
 |      a UnicodeEncodeError. Other possible values are 'ignore', 'replace' and
 |      'xmlcharrefreplace' as well as any other name registered with
 |      codecs.register_error that is able to handle UnicodeEncodeErrors.
 |  
 |  endswith(...)
 |      S.endswith(suffix[, start[, end]]) -> bool
 |      
 |      Return True if S ends with the specified suffix, False otherwise.
 |      With optional start, test S beginning at that position.
 |      With optional end, stop comparing S at that position.
 |      suffix can also be a tuple of strings to try.
 |  
 |  expandtabs(...)
 |      S.expandtabs([tabsize]) -> string
 |      
 |      Return a copy of S where all tab characters are expanded using spaces.
 |      If tabsize is not given, a tab size of 8 characters is assumed.
 |  
 |  find(...)
 |      S.find(sub [,start [,end]]) -> int
 |      
 |      Return the lowest index in S where substring sub is found,
 |      such that sub is contained within S[start:end].  Optional
 |      arguments start and end are interpreted as in slice notation.
 |      
 |      Return -1 on failure.
 |  
 |  format(...)
 |      S.format(*args, **kwargs) -> string
 |      
 |      Return a formatted version of S, using substitutions from args and kwargs.
 |      The substitutions are identified by braces ('{' and '}').
 |  
 |  index(...)
 |      S.index(sub [,start [,end]]) -> int
 |      
 |      Like S.find() but raise ValueError when the substring is not found.
 |  
 |  isalnum(...)
 |      S.isalnum() -> bool
 |      
 |      Return True if all characters in S are alphanumeric
 |      and there is at least one character in S, False otherwise.
 |  
 |  isalpha(...)
 |      S.isalpha() -> bool
 |      
 |      Return True if all characters in S are alphabetic
 |      and there is at least one character in S, False otherwise.
 |  
 |  isdigit(...)
 |      S.isdigit() -> bool
 |      
 |      Return True if all characters in S are digits
 |      and there is at least one character in S, False otherwise.
 |  
 |  islower(...)
 |      S.islower() -> bool
 |      
 |      Return True if all cased characters in S are lowercase and there is
 |      at least one cased character in S, False otherwise.
 |  
 |  isspace(...)
 |      S.isspace() -> bool
 |      
 |      Return True if all characters in S are whitespace
 |      and there is at least one character in S, False otherwise.
 |  
 |  istitle(...)
 |      S.istitle() -> bool
 |      
 |      Return True if S is a titlecased string and there is at least one
 |      character in S, i.e. uppercase characters may only follow uncased
 |      characters and lowercase characters only cased ones. Return False
 |      otherwise.
 |  
 |  isupper(...)
 |      S.isupper() -> bool
 |      
 |      Return True if all cased characters in S are uppercase and there is
 |      at least one cased character in S, False otherwise.
 |  
 |  join(...)
 |      S.join(iterable) -> string
 |      
 |      Return a string which is the concatenation of the strings in the
 |      iterable.  The separator between elements is S.
 |  
 |  ljust(...)
 |      S.ljust(width[, fillchar]) -> string
 |      
 |      Return S left-justified in a string of length width. Padding is
 |      done using the specified fill character (default is a space).
 |  
 |  lower(...)
 |      S.lower() -> string
 |      
 |      Return a copy of the string S converted to lowercase.
 |  
 |  lstrip(...)
 |      S.lstrip([chars]) -> string or unicode
 |      
 |      Return a copy of the string S with leading whitespace removed.
 |      If chars is given and not None, remove characters in chars instead.
 |      If chars is unicode, S will be converted to unicode before stripping
 |  
 |  partition(...)
 |      S.partition(sep) -> (head, sep, tail)
 |      
 |      Search for the separator sep in S, and return the part before it,
 |      the separator itself, and the part after it.  If the separator is not
 |      found, return S and two empty strings.
 |  
 |  replace(...)
 |      S.replace(old, new[, count]) -> string
 |      
 |      Return a copy of string S with all occurrences of substring
 |      old replaced by new.  If the optional argument count is
 |      given, only the first count occurrences are replaced.
 |  
 |  rfind(...)
 |      S.rfind(sub [,start [,end]]) -> int
 |      
 |      Return the highest index in S where substring sub is found,
 |      such that sub is contained within S[start:end].  Optional
 |      arguments start and end are interpreted as in slice notation.
 |      
 |      Return -1 on failure.
 |  
 |  rindex(...)
 |      S.rindex(sub [,start [,end]]) -> int
 |      
 |      Like S.rfind() but raise ValueError when the substring is not found.
 |  
 |  rjust(...)
 |      S.rjust(width[, fillchar]) -> string
 |      
 |      Return S right-justified in a string of length width. Padding is
 |      done using the specified fill character (default is a space)
 |  
 |  rpartition(...)
 |      S.rpartition(sep) -> (head, sep, tail)
 |      
 |      Search for the separator sep in S, starting at the end of S, and return
 |      the part before it, the separator itself, and the part after it.  If the
 |      separator is not found, return two empty strings and S.
 |  
 |  rsplit(...)
 |      S.rsplit([sep [,maxsplit]]) -> list of strings
 |      
 |      Return a list of the words in the string S, using sep as the
 |      delimiter string, starting at the end of the string and working
 |      to the front.  If maxsplit is given, at most maxsplit splits are
 |      done. If sep is not specified or is None, any whitespace string
 |      is a separator.
 |  
 |  rstrip(...)
 |      S.rstrip([chars]) -> string or unicode
 |      
 |      Return a copy of the string S with trailing whitespace removed.
 |      If chars is given and not None, remove characters in chars instead.
 |      If chars is unicode, S will be converted to unicode before stripping
 |  
 |  split(...)
 |      S.split([sep [,maxsplit]]) -> list of strings
 |      
 |      Return a list of the words in the string S, using sep as the
 |      delimiter string.  If maxsplit is given, at most maxsplit
 |      splits are done. If sep is not specified or is None, any
 |      whitespace string is a separator and empty strings are removed
 |      from the result.
 |  
 |  splitlines(...)
 |      S.splitlines(keepends=False) -> list of strings
 |      
 |      Return a list of the lines in S, breaking at line boundaries.
 |      Line breaks are not included in the resulting list unless keepends
 |      is given and true.
 |  
 |  startswith(...)
 |      S.startswith(prefix[, start[, end]]) -> bool
 |      
 |      Return True if S starts with the specified prefix, False otherwise.
 |      With optional start, test S beginning at that position.
 |      With optional end, stop comparing S at that position.
 |      prefix can also be a tuple of strings to try.
 |  
 |  strip(...)
 |      S.strip([chars]) -> string or unicode
 |      
 |      Return a copy of the string S with leading and trailing
 |      whitespace removed.
 |      If chars is given and not None, remove characters in chars instead.
 |      If chars is unicode, S will be converted to unicode before stripping
 |  
 |  swapcase(...)
 |      S.swapcase() -> string
 |      
 |      Return a copy of the string S with uppercase characters
 |      converted to lowercase and vice versa.
 |  
 |  title(...)
 |      S.title() -> string
 |      
 |      Return a titlecased version of S, i.e. words start with uppercase
 |      characters, all remaining cased characters have lowercase.
 |  
 |  translate(...)
 |      S.translate(table [,deletechars]) -> string
 |      
 |      Return a copy of the string S, where all characters occurring
 |      in the optional argument deletechars are removed, and the
 |      remaining characters have been mapped through the given
 |      translation table, which must be a string of length 256 or None.
 |      If the table argument is None, no translation is applied and
 |      the operation simply removes the characters in deletechars.
 |  
 |  upper(...)
 |      S.upper() -> string
 |      
 |      Return a copy of the string S converted to uppercase.
 |  
 |  zfill(...)
 |      S.zfill(width) -> string
 |      
 |      Pad a numeric string S with zeros on the left, to fill a field
 |      of the specified width.  The string S is never truncated.
 |  
 |  ----------------------------------------------------------------------
 |  Data and other attributes defined here:
 |  
 |  __new__ = <built-in method __new__ of type object>
 |      T.__new__(S, ...) -> a new object with type S, a subtype of T

>>> mystring.capitalize()
'Hello csci 150!'
>>> mystring.upper()
'HELLO CSCI 150!'
>>> mystring
'Hello CSCI 150!'
>>> help(str.count)
Help on method_descriptor:

count(...)
    S.count(sub[, start[, end]]) -> int
    
    Return the number of non-overlapping occurrences of substring sub in
    string S[start:end].  Optional arguments start and end are interpreted
    as in slice notation.

>>> mystring.count(' ')
2
>>> bananas = "Banana banana" * 6
>>> bananas.count("na")
24
>>> help(str.replace)
Help on method_descriptor:

replace(...)
    S.replace(old, new[, count]) -> string
    
    Return a copy of string S with all occurrences of substring
    old replaced by new.  If the optional argument count is
    given, only the first count occurrences are replaced.

>>> bananas.replace("na", "ca")
'Bacaca bacacaBacaca bacacaBacaca bacacaBacaca bacacaBacaca bacacaBacaca bacaca'
>>> help(str.isdigit)
Help on method_descriptor:

isdigit(...)
    S.isdigit() -> bool
    
    Return True if all characters in S are digits
    and there is at least one character in S, False otherwise.

>>> mystring.isdigit()
False
>>> '298634'.isdigit()
True
>>> int('three')

Traceback (most recent call last):
  File "<pyshell#31>", line 1, in <module>
    int('three')
ValueError: invalid literal for int() with base 10: 'three'
>>> help(str.find)
Help on method_descriptor:

find(...)
    S.find(sub [,start [,end]]) -> int
    
    Return the lowest index in S where substring sub is found,
    such that sub is contained within S[start:end].  Optional
    arguments start and end are interpreted as in slice notation.
    
    Return -1 on failure.

>>> mystring.find('CSCI')
6
>>> mystring[6]
'C'
>>> mystring.find('x')
-1
>>> CSCI_position = mystring.find('CSCI')
>>> mystring[:CSCI_position]
'Hello '
>>> dna = 'tatacgcgataccaaataagatgtcaggacgtggaaagggaggaaaaggcctcggaaaaggtggtgccaagcgccatcgcaaggtccttcgagacaacatccaaggaatcaccaagccagctattcgccgtcttgctcgtcgtggtggagtcaagcgtatttctggactcatctatgaggaaactcgtggagttctcaaggtgttcctcgagaacgtcatccgtgatgccgtaacttactgtgagcacgccaagagaaagaccgttaccgccatggacgtcgtctacgctttgaagcgtcaaggaagaactctgtacggattcggaggataataccattgaggggcaaaaa'
>>> dna.count(' ')
0
>>> dna.count('\n')
0
>>> dna.upper()
'TATACGCGATACCAAATAAGATGTCAGGACGTGGAAAGGGAGGAAAAGGCCTCGGAAAAGGTGGTGCCAAGCGCCATCGCAAGGTCCTTCGAGACAACATCCAAGGAATCACCAAGCCAGCTATTCGCCGTCTTGCTCGTCGTGGTGGAGTCAAGCGTATTTCTGGACTCATCTATGAGGAAACTCGTGGAGTTCTCAAGGTGTTCCTCGAGAACGTCATCCGTGATGCCGTAACTTACTGTGAGCACGCCAAGAGAAAGACCGTTACCGCCATGGACGTCGTCTACGCTTTGAAGCGTCAAGGAAGAACTCTGTACGGATTCGGAGGATAATACCATTGAGGGGCAAAAA'
>>> dna = dna.upper()
>>> dna
'TATACGCGATACCAAATAAGATGTCAGGACGTGGAAAGGGAGGAAAAGGCCTCGGAAAAGGTGGTGCCAAGCGCCATCGCAAGGTCCTTCGAGACAACATCCAAGGAATCACCAAGCCAGCTATTCGCCGTCTTGCTCGTCGTGGTGGAGTCAAGCGTATTTCTGGACTCATCTATGAGGAAACTCGTGGAGTTCTCAAGGTGTTCCTCGAGAACGTCATCCGTGATGCCGTAACTTACTGTGAGCACGCCAAGAGAAAGACCGTTACCGCCATGGACGTCGTCTACGCTTTGAAGCGTCAAGGAAGAACTCTGTACGGATTCGGAGGATAATACCATTGAGGGGCAAAAA'
>>> dna[0:10]
'TATACGCGAT'
>>> dna[-1:-11]
''
>>> dna[-10:]
'GGGGCAAAAA'
>>> dna[-11:]
'AGGGGCAAAAA'
>>> dna[-10:]
'GGGGCAAAAA'
>>> ================================ RESTART ================================
>>> 
>>> explode('grapes')
g
r
a
p
e
>>> ================================ RESTART ================================
>>> 
>>> explode('grapes')
g
r
a
p
e
s
>>> ================================ RESTART ================================
>>> 
>>> explode('grapes')
g
r
a
p
e
s

Traceback (most recent call last):
  File "<pyshell#51>", line 1, in <module>
    explode('grapes')
  File "/home/brent/teaching/150/csci150/lectures/python/strings.py", line 36, in explode
    print s[index]
IndexError: string index out of range
>>> ================================ RESTART ================================
>>> 
>>> explode('grapes')
g
r
a
p
e
s
>>> ================================ RESTART ================================
>>> 
>>> explode2('grapes')
g
r
a
p
e
s
>>>